LentiCRISPR v2 hBAX
(Plasmid
#129580)
-
PurposeCRISPR deletion of human BAX
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPRv2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA vs human BAX
-
gRNA/shRNA sequenceAGTAGAAAAGGGCGACAACC
-
SpeciesH. sapiens (human)
-
MutationNone
-
Entrez GeneBAX (a.k.a. BCL2L4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR v2 hBAX was a gift from Stephen Tait (Addgene plasmid # 129580 ; http://n2t.net/addgene:129580 ; RRID:Addgene_129580) -
For your References section:
Mito-priming as a method to engineer Bcl-2 addiction. Lopez J, Bessou M, Riley JS, Giampazolias E, Todt F, Rochegue T, Oberst A, Green DR, Edlich F, Ichim G, Tait SW. Nat Commun. 2016 Feb 2;7:10538. doi: 10.1038/ncomms10538. 10.1038/ncomms10538 PubMed 26833356