pBN449
(Plasmid #129555)

• Purpose: GAL4-induced expression of codon optimised FLP recombinase in C. elegans
• Depositing Lab: Peter Askjaer
• Publication: Ayuso et al MicroPubl Biol. 2019 Jan 29;2019:10.17912/micropub.biology.000089. doi: 10.17912/micropub.biology.000089.

Backbone

• Vector backbone: pBN412
• Total vector size (bp): 11121
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 15xUAS
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 393
• Tags / Fusion Proteins:
  • FLP
  • mNeonGreen

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (destroyed during cloning)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: gctctgcgagaaatagtacagca
• 3′ sequencing primer: TCGACGAATTGACGGACGAGGA

Resource Information

• Supplemental Documents:
  • pBN449_UAS_FLP_D5_mNG_MSCI_IV.gb
• A portion of this plasmid was derived from a plasmid made by: Paul Sternberg lab (CalTech)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

15xUAS sequence from pHW394 inserted into pBN412