Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC57-PB-PGK-tetR-KRAB-2A-Puro
(Plasmid #129536)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129536 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC57
  • Backbone size w/o insert (bp) 2726
  • Total vector size (bp) 5650
  • Vector type
    Unspecified
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PB-PGK-tetR-KRAB-2A-Puro
  • Species
    Synthetic
  • Insert Size (bp)
    2924
  • Promoter hPGK promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GATGTGCTGCAAGGCGATTA
  • 3′ sequencing primer TTATGCTTCCGGCTCGTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC57-PB-PGK-tetR-KRAB-2A-Puro was a gift from Hideyuki Okano (Addgene plasmid # 129536 ; http://n2t.net/addgene:129536 ; RRID:Addgene_129536)
  • For your References section:

    Controlling gene activation by enhancers through a drug-inducible topological insulator. Tsujimura T, Takase O, Yoshikawa M, Sano E, Hayashi M, Hoshi K, Takato T, Toyoda A, Okano H, Hishikawa K. Elife. 2020 May 5;9. pii: 47980. doi: 10.7554/eLife.47980. 10.7554/eLife.47980 PubMed 32369019