Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p1195-pssAAV.U1a.hNme2Cas9
(Plasmid #129534)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129534 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 3326
  • Total vector size (bp) 6833
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human codon-optimized Nme2Cas9
  • Alt name
    Nme2Cas9c
  • Promoter U1a
  • Tags / Fusion Proteins
    • 2xNLS (N terminal on insert)
    • NLS-3xHA-NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cgtggccacgcaactcatac
  • 3′ sequencing primer ccgccgagtgagagacacaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p1195-pssAAV.U1a.hNme2Cas9 was a gift from Erik Sontheimer (Addgene plasmid # 129534 ; http://n2t.net/addgene:129534 ; RRID:Addgene_129534)
  • For your References section:

    Tissue-restricted Genome Editing in vivo Specified by MicroRNA-repressible Anti-CRISPR Proteins. Lee J, Mou H, Ibraheim R, Liang SQ, Liu P, Xue W, Sontheimer EJ. RNA. 2019 Aug 22. pii: rna.071704.119. doi: 10.1261/rna.071704.119. 10.1261/rna.071704.119 PubMed 31439808