p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
(Plasmid #129530)

• Purpose: Self-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme
• Depositing Lab: Erik Sontheimer
• Publication: Lee et al RNA. 2019 Aug 22. pii: rna.071704.119. doi: 10.1261/rna.071704.119.

Backbone

• Vector backbone: scAAV
• Total vector size (bp): 5019
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: codon-optimized AcrIIC3Nme
• Insert Size (bp): 348
• Promoter: cytomegalovirus-enhancer chicken β-actin promoter with SV40-derived mini-intron
• Tag / Fusion Protein:
  • FLAG/NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: tacggtaaatggcccgcctg
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Gene/Insert 2

• Gene/Insert name: sgRNA_Rosa26
• Insert Size (bp): 145
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CTCTAGGAAGATCAATTCGGTA
• 3′ sequencing primer: GAGGGCCTATTTCCCATGATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry