pSL1103
(Plasmid
#129526)
-
PurposepDEF-SpCas9, No Target Control Vector for CRISPRi, PbEF1a promoter, 1st Generation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEF
-
Vector typePlasmodium, rodent-infectious species
-
Selectable markersPyrimethamine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedSpCas9
-
gRNA/shRNA sequenceGGCGAGGGCCGCCCCTACGA
-
SpeciesS. pyogenes
-
Insert Size (bp)4269
-
Tag
/ Fusion Protein
- NLS, 1xHA
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGene origin for dSpCas9 is from Addgene #48240
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSL1103 was a gift from Scott Lindner (Addgene plasmid # 129526 ; http://n2t.net/addgene:129526 ; RRID:Addgene_129526) -
For your References section:
Ribozyme-mediated, multiplex CRISPR gene editing and CRISPR interference (CRISPRi) in rodent-infectious Plasmodium yoelii. Walker MP, Lindner SE. J Biol Chem. 2019 Jun 14;294(24):9555-9566. doi: 10.1074/jbc.RA118.007121. Epub 2019 May 1. 10.1074/jbc.RA118.007121 PubMed 31043479