pgRNA-guideless
(Plasmid #129464)

• Purpose: Derived from pSCB2-sgRNA. 20 nucleotide binding sequence of sgRNA removed by inverse PCR. Used as a negative control.
• Depositing Lab: Silvia Cardona
• Publication: Hogan et al ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232.

Backbone

• Vector backbone: pSCrhaB2
• Backbone manufacturer: Miguel Valvano and Silvia Cardona
• Backbone size w/o insert (bp): 5451
• Total vector size (bp): 5581
• Modifications to backbone: pSCB2-sgRNA is the actual vector backbone. Rhamnose-inducible promoter system removed via inverse PCR. Additional inverse PCR removal of 20 nucleotide target. Negative control, incapable of binding to chromosome.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Trimethoprim
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Guideless gRNA backbone
• gRNA/shRNA sequence: N/A
• Species: Synthetic
• GenBank ID: MH319949.1
• Promoter: BBa_J23119 (SpeI)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TAAGATggatccTCAGTTGGCTTCATCGCTAC
• 3′ sequencing primer: CCGCCAGGCAAATTCTGTTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: gRNA scaffold used in construction of pgRNA-bacteria from Qi et al. (2013).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry