pSCB2-sgRNA
(Plasmid #129463)

• Purpose: Template plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).
• Depositing Lab: Silvia Cardona
• Publication: Hogan et al ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232.

Backbone

• Vector backbone: pSCrhaB2
• Backbone manufacturer: Miguel Valvano and Silvia Cardona
• Backbone size w/o insert (bp): 5451
• Total vector size (bp): 5601
• Modifications to backbone: Removal of RhaS, RhaR, and truncation of PrhaBAD. Addition of gRNA scaffold under the control of the J23119 promoter. Restriction cloning used to insert scaffold from pgRNA-bacteria.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Trimethoprim
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: pgRNA
• gRNA/shRNA sequence: AACTTTCAGTTTAGCGGTCT
• Species: Synthetic
• GenBank ID: MH319949.1
• Promoter: BBa_J23119 (SpeI)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAAGATggatccTCAGTTGGCTTCATCGCTAC
• 3′ sequencing primer: CCGCCAGGCAAATTCTGTTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Original sgRNA under control of J23119 promoter constructed by Lei Qi et al. (2013). Recognizes intergenic region in E. coli.