pFB1_hMLH1
(Plasmid #129426)

• Purpose: Expression human MLH1 protein using baculovirus
• Depositing Lab: Peggy Hsieh
• Publication: Geng et al Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15.

Backbone

• Vector backbone: pFastBac 1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4776
• Total vector size (bp): 6966
• Modifications to backbone: hMLH1 is inserted in MCS (5'- BamH 1 and 3'- Xho I) of pFastBac 1. 5' sequencing primer covers nucleotides from 161-124 of hMLH1, but antiparallel, 3' sequencing primer covers nucleotides from 2148-2175 of hMLH1. They are used to sequence junction of the insert. The plasmid is used to amplify and generate recombinant bacmid DNA. which will then be transfected into insect cells for virus generation and eventually protein (hMLH1) expression.
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use DH10Bac for bacmid expression.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human MLH1
• Alt name: DNA mismatch repair protein homolog (MLH1)
• Species: H. sapiens (human)
• Insert Size (bp): 2271
• GenBank ID: U07343
• Entrez Gene: MLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, LYNCH2, MLH-1, MMRCS1, hMLH1)
• Promoter: Polyhedrin promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: Xho I (not destroyed)
• 5′ sequencing primer: ccctctttaacaatcacttgaatacttgtggattttgc
• 3′ sequencing primer: ggaacacattgtctataaagccttgcgc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry