-
Purpose(mNeonGreen)4-tDeg fluorogenic protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name(mNeonGreen)4-tDeg
-
SpeciesSynthetic
-
Insert Size (bp)3042
-
GenBank IDMN052907 MN052907
- Promoter UbC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTTTTCTTTCCAGAGAGCGGAACAGGCG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UbC-(mNeonGreen)4-tDeg was a gift from Samie Jaffrey (Addgene plasmid # 129404 ; http://n2t.net/addgene:129404 ; RRID:Addgene_129404) -
For your References section:
Live imaging of mRNA using RNA-stabilized fluorogenic proteins. Wu J, Zaccara S, Khuperkar D, Kim H, Tanenbaum ME, Jaffrey SR. Nat Methods. 2019 Sep;16(9):862-865. doi: 10.1038/s41592-019-0531-7. Epub 2019 Aug 30. 10.1038/s41592-019-0531-7 PubMed 31471614