pAAV-CaMKII-STChRger2-TS-EYFP
(Plasmid #129393)

• Purpose: Soma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.
• Depositing Lab: Viviana Gradinaru
• Publication: Bedbrook et al Nat Methods. 2019 Oct 14. pii: 10.1038/s41592-019-0583-8. doi: 10.1038/s41592-019-0583-8.

Backbone

• Vector backbone: pAAV CaMKIIa WPRE pA
• Backbone size w/o insert (bp): 5076
• Total vector size (bp): 7125
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: soma targeted ChRger2
• Alt name: STChRger2
• Insert Size (bp): 2049
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • Kv2.1-TS-EYFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GcttcgttacGCCgagtgg
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • Annotated Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene NGS results detect a mixed population at base 2849 (T/G), which could result in a D21Y variant in EYFP. This construct fluoresces as expected.

Depositor has evidence that soma-targeted constructs may have different optical properties from their parent ChRgers and they have not been fully characterized. Users should be aware that they are beta-testing.