pAH-CTX1-rhadCas9-native
(Plasmid #129392)

• Purpose: Derived from pAH-CTX1-rha. The native Streptococcus pyogenes dCas9 gene cloned downstream of PrhaBAD. Non-codon-optimized dCas9 version of pAH-CTX1-rhadCas9.
• Depositing Lab: Silvia Cardona
• Publication: Hogan et al ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232.

Backbone

• Vector backbone: pAH-CTX1-rha
• Backbone manufacturer: Andrew Hogan
• Backbone size w/o insert (bp): 7649
• Total vector size (bp): 11897
• Modifications to backbone: Insertion of Streptococcus pyogenes dCas9
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. pyogenes dCas9
• Species: S. pyogenes
• Insert Size (bp): 4248
• Mutation: Aspartate 10 to Alanine, Histidine 840 to Alanine
• GenBank ID: AE004092.2
• Promoter: PrhaBAD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGGTTCTATCGCCACGGAC
• 3′ sequencing primer: CTTCCGCTGTCTCTCCACTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dCas9 designed for S. pyogenes was cloned by Qi et al. (2013). The plasmid, 44249, was distributed by Addgene.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry