pAH-CTX1-rha
(Plasmid #129390)

• Purpose: Derived from mini-CTX1. An integrase vector that can integrate the rhamnose-inducible promoter system into the chromosome of a host bacterium.
• Depositing Lab: Silvia Cardona
• Publication: Hogan et al ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232.

Backbone

• Vector backbone: mini-CTX1
• Backbone manufacturer: Hoang TT
• Backbone size w/o insert (bp): 5610
• Total vector size (bp): 7656
• Modifications to backbone: Insertion of the rhamnose-inducible promoter system from Escherichia coli (derived from pSC201).
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rhamnose-inducible promoter
• Species: E. coli
• Insert Size (bp): 2088
• Mutation: N/A
• GenBank ID: CP037857.1
• Promoter: PrhaBAD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GTCAGCAATTTCGCCAGCAG
• 3′ sequencing primer: AAGTGGATCAGCAAGGACGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Rhamnose-inducible promoter was originally found in E. coli. The system was cloned from a vector in the Cardona lab, known as pSC201.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry