pAH25-SceI
(Plasmid #129389)

• Purpose: Derived from pDAI-SceI. Tetracycline resistance removed and replaced with chloramphenicol resistance cassette from pKD3.
• Depositing Lab: Silvia Cardona
• Publication: Hogan et al ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232.

Backbone

• Vector backbone: pDAI-SceI
• Backbone manufacturer: Daniel Aubert
• Backbone size w/o insert (bp): 8031
• Total vector size (bp): 6496
• Modifications to backbone: Removal of tetracycline resistance cassette and insertion of pKD3 chloramphenicol resistance cassette.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Chloramphenicol acetyltransferase
• Alt name: cat
• Species: S. sonnei
• Insert Size (bp): 857
• Mutation: N/A
• GenBank ID: HF570110.1
• Promoter: CAT promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: AATTAAaccggtACTCATCGCAGTACTGTTGTATTC
• 3′ sequencing primer: ACTGCCTACCCCACAACAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The cat cassette was provided in the pKD3 vector, constructed by Datsenko et al. (2000). The pKD3 vector was provided by the lab of Barry L. Wanner (Department of Genetics Harvard Medical School).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry