pAH25-SceI
(Plasmid
#129389)
-
PurposeDerived from pDAI-SceI. Tetracycline resistance removed and replaced with chloramphenicol resistance cassette from pKD3.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDAI-SceI
-
Backbone manufacturerDaniel Aubert
- Backbone size w/o insert (bp) 8031
- Total vector size (bp) 6496
-
Modifications to backboneRemoval of tetracycline resistance cassette and insertion of pKD3 chloramphenicol resistance cassette.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChloramphenicol acetyltransferase
-
Alt namecat
-
SpeciesS. sonnei
-
Insert Size (bp)857
-
MutationN/A
-
GenBank IDHF570110.1
- Promoter CAT promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AATTAAaccggtACTCATCGCAGTACTGTTGTATTC
- 3′ sequencing primer ACTGCCTACCCCACAACAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe cat cassette was provided in the pKD3 vector, constructed by Datsenko et al. (2000). The pKD3 vector was provided by the lab of Barry L. Wanner (Department of Genetics Harvard Medical School).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAH25-SceI was a gift from Silvia Cardona (Addgene plasmid # 129389 ; http://n2t.net/addgene:129389 ; RRID:Addgene_129389) -
For your References section:
A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085