pEGFP-N1-mCherry-ApoB-TagBFP
(Plasmid #129383)

• Purpose: Plasmid bearing the editing target of APOBEC1 fused between the mCherry and the Tag-BFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of Tag-BFP
• Depositing Lab: Silvestro Conticello
• Publication: Chieca et al Methods Mol Biol. 2021;2181:69-81. doi: 10.1007/978-1-0716-0787-9_5.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3939
• Total vector size (bp): 5835
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-ApoB-Tag-BFP
• Species: Synthetic
• Insert Size (bp): 1896
• Promoter: CMV promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: TTCAGGTTCAGGGGGAGGTG

Resource Information

• Supplemental Documents:
  • pEGFPN1-mCherry-ApoB-Tag-BFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry