pLL1273
(Plasmid #129288)

• Purpose: Expression plasmid with pLL1270 as backbone and alpha-Xylp_1211 and alpha-L-Galp_687 as inserts
• Depositing Lab: Lee Lynd
• Publication: Expression of arabinoxylan debranching enzymes in Thermoanaerobacterium thermosaccharolyticum- Bacterial expression plasmids (unpublished)

Backbone

• Vector backbone: pLL1270
• Backbone size w/o insert (bp): 7210
• Total vector size (bp): 11549
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: alpha-Xylp_1211 (Ga0256695_ 1211)
• Species: LL1355
• Insert Size (bp): 1980
• GenBank ID: NZ_RSDX01000001
• Promoter: Clostridium thermocellum DSM1313 Cellobiose phosphorylase (CBP) Clo1313_1954

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTATAGAGCTTAGGGAGAGG
• 3′ sequencing primer: CTGTCAAATATCGCCTTC

Gene/Insert 2

• Gene/Insert name: alpha-L-Galp_687 (Ga0256695_ 0687)
• Species: LL1355
• Insert Size (bp): 2004
• GenBank ID: NZ_RSDX01000001
• Promoter: Clostridium thermocellum DSM1313 Cellobiose phosphorylase (CBP) Clo1313_1954

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCAAGTCAACCTATCCAA
• 3′ sequencing primer: CTGATTATTGCCCTCGTA

Resource Information

• Supplemental Documents:
  • pLL1273.1

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry