pGAN213
(Plasmid
#129270)
-
PurposeControl for measuring background levels of yTRAP reporter protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGAN147
-
Backbone manufacturerGregory Newby
- Total vector size (bp) 7233
-
Modifications to backboneRemoved synTA expression cassette
-
Vector typeYeast Expression
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter min pCYC1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site DraIII (destroyed during cloning)
- 3′ cloning site PacI (destroyed during cloning)
- 5′ sequencing primer cagcactaaagttgcctggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
reporter only (no yTRAP fusion). 8xop-crCYC1p-NeonGreen-ADH1term.
for measuring background levels of reporter protein
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAN213 was a gift from Ahmad Khalil (Addgene plasmid # 129270 ; http://n2t.net/addgene:129270 ; RRID:Addgene_129270) -
For your References section:
A Genetic Tool to Track Protein Aggregates and Control Prion Inheritance. Newby GA, Kiriakov S, Hallacli E, Kayatekin C, Tsvetkov P, Mancuso CP, Bonner JM, Hesse WR, Chakrabortee S, Manogaran AL, Liebman SW, Lindquist S, Khalil AS. Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.041 PubMed 29056345