Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSK221
(Plasmid #129249)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129249 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNH605
  • Backbone manufacturer
    Wendell Lim
  • Backbone size w/o insert (bp) 9632
  • Total vector size (bp) 7428
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pADH1(tetO2)-mNeonGreen
  • Species
    Synthetic
  • Insert Size (bp)
    2202
  • Promoter ADH1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTTGTGCATTCGCATGTATCGG
  • 3′ sequencing primer taagcaaatagctaaattatatacgaattaatattatgattaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is the second reporter of the reverse yTRAP system. Use it in combination with an expression clone resulting from pGAN230. pSK221 should be linearized with PmeI enzyme prior to integration into the yeast genome.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSK221 was a gift from Ahmad Khalil (Addgene plasmid # 129249 ; http://n2t.net/addgene:129249 ; RRID:Addgene_129249)
  • For your References section:

    A Genetic Tool to Track Protein Aggregates and Control Prion Inheritance. Newby GA, Kiriakov S, Hallacli E, Kayatekin C, Tsvetkov P, Mancuso CP, Bonner JM, Hesse WR, Chakrabortee S, Manogaran AL, Liebman SW, Lindquist S, Khalil AS. Cell. 2017 Nov 2;171(4):966-979.e18. doi: 10.1016/j.cell.2017.09.041. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.041 PubMed 29056345