Skip to main content
Addgene

pExp-Calm
(Plasmid #129238)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129238 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOP2S
  • Modifications to backbone
    Contains N-terminal 8xHis, fusion partner: Calm (Calmodulin-3 from Homo sapiens, UniProtKB: P0DP25) followed by TEV protease cleavage site, optional C-terminal StrepII-tag. Cloning of GOI between BsaI and XhoI or HindIII.
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Strep (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pOP_up: TACGACTCACTATAGGGAATTGTGAGC
  • 3′ sequencing primer pOP_dn: GCAGCCAACTCAGCTTCCTTTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pExp-Calm was a gift from Marko Hyvönen (Addgene plasmid # 129238 ; http://n2t.net/addgene:129238 ; RRID:Addgene_129238)