pExp-Lipo
(Plasmid
#129237)
-
Purpose(Empty Backbone) Protein expression in E.coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepOP2S
-
Modifications to backboneContains N-terminal 8xHis, fusion partner: Lipo (Lipoyl-binding domain of Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex from Geobacillus stearothermophilus, UniProtKB: P11961) followed by TEV protease cleavage site, optional C-terminal StrepII-tag. Cloning of GOI between BsaI and XhoI or HindIII.
-
Vector typeBacterial Expression
- Promoter T7
-
Tags
/ Fusion Proteins
- Strep (C terminal on backbone)
- His (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pOP_up: TACGACTCACTATAGGGAATTGTGAGC
- 3′ sequencing primer pOP_dn: GCAGCCAACTCAGCTTCCTTTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pExp-Lipo was a gift from Marko Hyvönen (Addgene plasmid # 129237 ; http://n2t.net/addgene:129237 ; RRID:Addgene_129237)
