pGRCRE
(Plasmid
#129116)
-
PurposeExpresses cre recombinase in Z. rouxii yeast cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCg2XpH-N
-
Modifications to backboneTwo pHluorins are replaced with cre recombinase encoding gene under S. cerevisiae GAL1 promoter
-
Vector typeYeast Expression, Cre/Lox
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecre
-
Alt namecre recombinase
- Promoter S. cerevisiae GAL1 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCGCGTTGGCCGATTCATTAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains 62 additional basepairs in the backbone between the f1 ori and C. glabrata ACT1 feature compared to the depositor's sequence. This difference is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGRCRE was a gift from Paolo Giudici (Addgene plasmid # 129116 ; http://n2t.net/addgene:129116 ; RRID:Addgene_129116) -
For your References section:
A set of plasmids carrying antibiotic resistance markers and Cre recombinase for genetic engineering of nonconventional yeast Zygosaccharomyces rouxii. Bizzarri M, Cassanelli S, Duskova M, Sychrova H, Solieri L. Yeast. 2019 Dec;36(12):711-722. doi: 10.1002/yea.3438. Epub 2019 Sep 11. 10.1002/yea.3438 PubMed 31414502