XR1_pHCLYBL-CAG-LSL-GFP-P2A-RFP
(Plasmid #129111)

• Purpose: Homologous recombination vector for excision reporter 1 in the CLYBL locus.
• Depositing Lab: Bruce Conklin
• Publication: Excision Reporter (unpublished)

Backbone

• Vector backbone: unknown
• Total vector size (bp): 12595
• Vector type: Mammalian Expression, Cre/Lox, TALEN
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LSL, eGFP, NLS-RFP
• Species: H. sapiens (human)
• Promoter: CAG

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: gcaacgtgctggttattgtg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Chong Park

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry