co luxD pcDNA3.1(+)
(Plasmid #129088)

• Purpose: Expression of luxD in mammalian cells
• Depositing Lab: Stefan Hell
• Publication: Gregor et al Proc Natl Acad Sci U S A. 2019 Dec 2. pii: 1913616116. doi: 10.1073/pnas.1913616116.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone size w/o insert (bp): 5344
• Total vector size (bp): 6268
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: co luxD
• Alt name: codon-optimized luxD
• Species: Synthetic
• Insert Size (bp): 924
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TGACGCAAATGGGCGGTA
• 3′ sequencing primer: GAAAGGACAGTGGGAGTGGCA

Resource Information

• Supplemental Documents:
  • co luxD pcDNA3.1(+).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry