Skip to main content
Addgene

co luxB pcDNA3.1(+)
(Plasmid #129086)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129086 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5344
  • Total vector size (bp) 6328
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    co luxB
  • Alt name
    codon-optimized luxB
  • Species
    Synthetic
  • Insert Size (bp)
    984
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TGACGCAAATGGGCGGTA
  • 3′ sequencing primer GAAAGGACAGTGGGAGTGGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    co luxB pcDNA3.1(+) was a gift from Stefan Hell (Addgene plasmid # 129086 ; http://n2t.net/addgene:129086 ; RRID:Addgene_129086)
  • For your References section:

    Autonomous bioluminescence imaging of single mammalian cells with the bacterial bioluminescence system. Gregor C, Pape JK, Gwosch KC, Gilat T, Sahl SJ, Hell SW. Proc Natl Acad Sci U S A. 2019 Dec 2. pii: 1913616116. doi: 10.1073/pnas.1913616116. 10.1073/pnas.1913616116 PubMed 31792180