pSpdCas9-huTET1CD-T2A-GFP (PX458)
(Plasmid #129025)

• Purpose: targeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNA
• Depositing Lab: Julia K Polansky
• Publication: Kressler et al Front Immunol. 2021 Jan 7;11:609891. doi: 10.3389/fimmu.2020.609891. eCollection 2020.

Backbone

• Vector backbone: PX458
• Backbone manufacturer: Feng Zhang (Addgene plasmid # 48138)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: dCas9-huTET1CD, SgRNA cloning site
• Alt name: dCas9-huTET1CD-T2A-EGFP
• Species: Synthetic
• Mutation: dCas9 (D10A;H840A)
• Promoter: CbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)
• Tags / Fusion Proteins:
  • HA-Tag, NLS (N terminal on insert)
  • T2A-EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: SgRNA-cloning-site: hU6-F (GAGGGCCTATTTCCCATGATT)

Resource Information

• Supplemental Documents:
  • 1-pSpdCas9-huTET1CD-T2A-GFP.gb
• A portion of this plasmid was derived from a plasmid made by: HA tag-NLS-dCas9 from Rudolf Jaenisch (Addgene plasmid # 48223); huTET1CD from Keith Joung (Addgene plasmid # 49236)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For SgRNA cloning: Caution! BbsI cannot be used for SgRNA cloning in this plasmid, there are BbsI sites in TET1CD. Instead the guide sequence can be cloned into Addgene#48138 and in a second step transferred into this plasmid (for example using PvuI & XbaI).

This Plasmid was generated by Christopher Kressler.