pcDNA3.1(+) eGFP PPP1R8 G4
(Plasmid
#129021)
-
PurposeExpresses an eGFP mRNA with the PPP1R8 G-quadruplex (G4) region in the 3' UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerLife Technologies
- Total vector size (bp) 6422
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+) eGFP PPP1R8 G4 was a gift from Jeremy Wilusz (Addgene plasmid # 129021 ; http://n2t.net/addgene:129021 ; RRID:Addgene_129021) -
For your References section:
An improved method for circular RNA purification using RNase R that efficiently removes linear RNAs containing G-quadruplexes or structured 3' ends. Xiao MS, Wilusz JE. Nucleic Acids Res. 2019 Jul 3. pii: 5527976. doi: 10.1093/nar/gkz576. 10.1093/nar/gkz576 PubMed 31269210