Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pORTMAGE312B
(Plasmid #128969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128969 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSEVA258
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9839
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    PapRecT
  • Species
    P. aeruginosa
  • Insert Size (bp)
    747
  • GenBank ID
    WP_003088368
  • Promoter xylS-Pm

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATAAGTCCAGCCTTGCAAG
  • 3′ sequencing primer CACTAGTTCTTTGACTACCGACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mutL E32K
  • Alt name
    Dominant-Negative MutL
  • Species
    E. coli
  • Insert Size (bp)
    1848
  • Mutation
    E32K
  • GenBank ID
    NP_418591
  • Promoter xylS-Pm

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATAAGTCCAGCCTTGCAAG
  • 3′ sequencing primer GTTCTGAACAAATCCAGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORTMAGE312B was a gift from George Church (Addgene plasmid # 128969 ; http://n2t.net/addgene:128969 ; RRID:Addgene_128969)
  • For your References section:

    Improved bacterial recombineering by parallelized protein discovery. Wannier TM, Nyerges A, Kuchwara HM, Czikkely M, Balogh D, Filsinger GT, Borders NC, Gregg CJ, Lajoie MJ, Rios X, Pal C, Church GM. Proc Natl Acad Sci U S A. 2020 Jun 16;117(24):13689-13698. doi: 10.1073/pnas.2001588117. Epub 2020 May 28. 10.1073/pnas.2001588117 PubMed 32467157