Skip to main content
Addgene

pLenti-5HRE-GFP NeoR
(Plasmid #128960)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128960 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    LV 1-5
  • Total vector size (bp) 9282
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5X HRE of VEGF
  • Alt name
    VEGF
  • Alt name
    VEGFA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1569
  • Entrez Gene
    VEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
  • Promoter minimal CMV promoter
  • Tag / Fusion Protein
    • d2EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGTTTATTACAGGGACAGC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-5HRE-GFP NeoR was a gift from Carlos Carmona-Fontaine (Addgene plasmid # 128960 ; http://n2t.net/addgene:128960 ; RRID:Addgene_128960)

  • For your References section:

    The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment. Janska L, Anandi L, Kirchberger NC, Marinkovic ZS, Schachtner LT, Guzelsoy G, Carmona-Fontaine C. Dis Model Mech. 2021 Aug 1;14(8). pii: 271783. doi: 10.1242/dmm.048942. Epub 2021 Aug 18. 10.1242/dmm.048942 PubMed 34407185
Related items:
Commonly requested with: