pT7-L1T1L-NLuc
(Plasmid
#128942)
-
PurposeExpresses L1-NLuc gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep3E5
- Backbone size w/o insert (bp) 3073
- Total vector size (bp) 7614
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL1 minor core protein
-
Alt namelambda-3 protein
-
SpeciesMammalian orthoreovirus 1
-
Insert Size (bp)4541
-
GenBank ID
- Promoter T7 promotor
-
Tag
/ Fusion Protein
- Nanoluc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAAGAGCGCCCAATACGCAAAC
- 3′ sequencing primer CTTTGTTAGCAGCCGGATCCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-L1T1L-NLuc was a gift from Takeshi Kobayashi (Addgene plasmid # 128942 ; http://n2t.net/addgene:128942 ; RRID:Addgene_128942) -
For your References section:
In vivo live imaging of oncolytic mammalian orthoreovirus expressing NanoLuc luciferase in tumor xenograft mice. Kanai Y, Kawagishi T, Matsuura Y, Kobayashi T. J Virol. 2019 May 8. pii: JVI.00401-19. doi: 10.1128/JVI.00401-19. 10.1128/JVI.00401-19 PubMed 31068423