Skip to main content
Addgene

pX330-Utf1 gRNA
(Plasmid #128842)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128842 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Utf1 gRNA
  • gRNA/shRNA sequence
    CACCGCCATCCCCATCTCAAACCT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Utf1 (a.k.a. AI505934)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer n/a
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Utf1 gRNA was a gift from Yossi Buganim (Addgene plasmid # 128842 ; http://n2t.net/addgene:128842 ; RRID:Addgene_128842)

  • For your References section:

    Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Benchetrit H, Jaber M, Zayat V, Sebban S, Pushett A, Makedonski K, Zakheim Z, Radwan A, Maoz N, Lasry R, Renous N, Inbar M, Ram O, Kaplan T, Buganim Y. Cell Stem Cell. 2019 Jun 6;24(6):983-994.e7. doi: 10.1016/j.stem.2019.03.018. Epub 2019 Apr 25. 10.1016/j.stem.2019.03.018 PubMed 31031139
Related items:
Commonly requested with: