Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDT305
(Plasmid #128801)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128801 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDT305
  • Backbone size w/o insert (bp) 5592
  • Total vector size (bp) 16000
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    eGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9-Dnmt3a-Dnmt3l-T2A-eGFP + gRNA expression cassette + LV backbone
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    10408
  • Promoter hUBC promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGAAGCTCCGGTTTTGAACT
  • 3′ sequencing primer CATGTTAGAAGACTTCCTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDT305 was a gift from Bradley Bernstein (Addgene plasmid # 128801 ; http://n2t.net/addgene:128801 ; RRID:Addgene_128801)
  • For your References section:

    Epigenome editing strategies for the functional annotation of CTCF insulators. Tarjan DR, Flavahan WA, Bernstein BE. Nat Commun. 2019 Sep 18;10(1):4258. doi: 10.1038/s41467-019-12166-w. 10.1038/s41467-019-12166-w PubMed 31534142