Skip to main content
Addgene

pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-2
(Plasmid #128763)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128763 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSICO derivative
  • Backbone size w/o insert (bp) 8888
  • Total vector size (bp) 8888
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DIS3L2 sgRNA #2
  • gRNA/shRNA sequence
    GCCTCACCGTTTCTCCCCGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    DIS3L2 (a.k.a. FAM6A, PRLMNS, hDIS3L2)
  • Promoter mU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site BlpI (not destroyed)
  • 5′ sequencing primer mU6-F
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-2 was a gift from David Bartel (Addgene plasmid # 128763 ; http://n2t.net/addgene:128763 ; RRID:Addgene_128763)

  • For your References section:

    A Network of Noncoding Regulatory RNAs Acts in the Mammalian Brain. Kleaveland B, Shi CY, Stefano J, Bartel DP. Cell. 2018 Jul 12;174(2):350-362.e17. doi: 10.1016/j.cell.2018.05.022. Epub 2018 Jun 7. 10.1016/j.cell.2018.05.022 PubMed 29887379
Related items: