24xMoonTag-kif18b-STOP-24xSunTag-linker-24xPP7 (3’UTR translation reporter)
(Plasmid #128605)

• Purpose: Expresses 24xgp41 peptide array (MoonTag peptide array), followed by kif18b gene, STOP codon, 24xgcn4 peptide array (SunTag peptide array), linker and 24 repeats of PP7 hairpins.
• Depositing Lab: Marvin Tanenbaum
• Publication: Boersma et al Cell. 2019 Jun 5. pii: S0092-8674(19)30499-4. doi: 10.1016/j.cell.2019.05.001.

Backbone

• Vector backbone: pcDNA4/TO
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: 24xMoonTag
• Alt name: 24x gp41
• Promoter: Pcmv

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Gene/Insert 2

• Gene/Insert name: kinesin family member 18b
• Species: H. sapiens (human)
• Entrez Gene: KIF18B

Gene/Insert 3

• Gene/Insert name: 24xSunTag
• Alt name: 24xgcn4

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid has 24xSunTag and 24 repeats of PP7 hairpins in 3'UTR