Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

24xMoonTag-kif18b-24xPP7 (MoonTag translation reporter)
(Plasmid #128604)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128604 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA4/TO
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    24xMoonTag
  • Alt name
    24x gp41
  • Promoter Pcmv

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    kinesin family member 18b
  • Species
    H. sapiens (human)
  • Entrez Gene
    KIF18B

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid has 24 repeats of PP7 hairpins in 3'UTR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    24xMoonTag-kif18b-24xPP7 (MoonTag translation reporter) was a gift from Marvin Tanenbaum (Addgene plasmid # 128604 ; http://n2t.net/addgene:128604 ; RRID:Addgene_128604)
  • For your References section:

    Multi-Color Single-Molecule Imaging Uncovers Extensive Heterogeneity in mRNA Decoding. Boersma S, Khuperkar D, Verhagen BMP, Sonneveld S, Grimm JB, Lavis LD, Tanenbaum ME. Cell. 2019 Jun 5. pii: S0092-8674(19)30499-4. doi: 10.1016/j.cell.2019.05.001. 10.1016/j.cell.2019.05.001 PubMed 31178119