AAV-Syn-FLPX-rc [ChrimsonR-tdTomato]
(Plasmid #128589)

• Purpose: AAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: AAV-CAG-FLPX
• Backbone manufacturer: Epoch
• Backbone size w/o insert (bp): 4458
• Total vector size (bp): 6954
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChrimsonR-tdTomato
• Alt name: Chrimson K176R mutant- tdTomato
• Alt name: ChR88m19-tdTomato
• Alt name: Chlamydomonas noctigama channelrhodopsin K176R mutant-tdTomato
• Species: Synthetic; Chlamydomonas noctigama
• Insert Size (bp): 2496
• Mutation: Chrimson K176R mutant
• GenBank ID: KF992060
• Promoter: Syn
• Tag / Fusion Protein:
  • tdTomato (codon diversified version) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gcacgggcgcgaccatctgc
• 3′ sequencing primer: TAGCGTAAAAGGAGCAACATAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

Information for AAV8 (Catalog # 128589-AAV8)

Purpose

Ready-to-use AAV8 particles produced from AAV-Syn-FLPX-rc [ChrimsonR-tdTomato] (#128589). In addition to the viral particles, you will also receive purified AAV-Syn-FLPX-rc [ChrimsonR-tdTomato] plasmid DNA.

Syn-driven, Flp-dependent ChrimsonR-tdTomato expression. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV8
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Flp-independent expression.