pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT
(Plasmid
#128551)
-
PurposeLentiviral constitutive expression of Firefly luciferase under control of WT 3'UTR of human C20orf24.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPHAGE
- Backbone size w/o insert (bp) 8174
- Total vector size (bp) 10333
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtacagtgcaggggaaaga, tgtttgtggacgaagtaccg
- 3′ sequencing primer gccttatgcagttgctctcc, gggcggaaggatcaggac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT was a gift from Mohan Babu (Addgene plasmid # 128551 ; http://n2t.net/addgene:128551 ; RRID:Addgene_128551) -
For your References section:
Rewiring of the Human Mitochondrial Interactome during Neuronal Reprogramming Reveals Regulators of the Respirasome and Neurogenesis. Moutaoufik MT, Malty R, Amin S, Zhang Q, Phanse S, Gagarinova A, Zilocchi M, Hoell L, Minic Z, Gagarinova M, Aoki H, Stockwell J, Jessulat M, Goebels F, Broderick K, Scott NE, Vlasblom J, Musso G, Prasad B, Lamantea E, Garavaglia B, Rajput A, Murayama K, Okazaki Y, Foster LJ, Bader GD, Cayabyab FS, Babu M. iScience. 2019 Sep 4;19:1114-1132. doi: 10.1016/j.isci.2019.08.057. 10.1016/j.isci.2019.08.057 PubMed 31536960