Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMJA290
(Plasmid #128542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128542 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(+)/Zeo(+)
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 4784
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lipid binding Human TCR
  • Alt name
    MK764035*
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3029
  • Promoter bidirectional CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTGTGAGCCAGGGCATTGG
  • 3′ sequencing primer GACAATGCGATGCAATTTCCTCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lipid binding gamma delta TCR. 5' cloning site Esp31 (not destroyed). 3' cloning site Esp31 (not destroyed).

Addgene NGS found a single nucleotide deletion in the gamma chain, resulting in a frameshift and early termination of the translation, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory has confirmed that this TCR receptor is functional and has been recently successfully used in their lab

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA290 was a gift from Marcos Alcocer (Addgene plasmid # 128542 ; http://n2t.net/addgene:128542 ; RRID:Addgene_128542)