pMJA180
(Plasmid
#128538)
-
PurposeExpresses E coli Bir A protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPIC6alpha
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3607
-
Vector typeYeast Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Blasticidin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE coli BirA
-
Alt nameDF192_21550
-
SpeciesEscherichia coli
-
Insert Size (bp)967
- Promoter AOX1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
- 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
secreted E coli BirA a biotinylation synthetase protein in Pichia
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA180 was a gift from Marcos Alcocer (Addgene plasmid # 128538 ; http://n2t.net/addgene:128538 ; RRID:Addgene_128538) -
For your References section:
Production of in vivo biotinylated scFv specific to almond (Prunus dulcis) proteins by recombinant Pichia pastoris. de la Cruz S, Alcocer M, Madrid R, Garcia A, Martin R, Gonzalez I, Garcia T. J Biotechnol. 2016 Jun 10;227:112-9. doi: 10.1016/j.jbiotec.2016.04.024. Epub 2016 Apr 13. 10.1016/j.jbiotec.2016.04.024 PubMed 27085890