Skip to main content
Addgene

pMJA089
(Plasmid #128518)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128518 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPIC9
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8005
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Artificial gene for human lysozyme
  • Alt name
    Lyz or X75362.1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    393
  • Entrez Gene
    LYZ (a.k.a. LYZF1, LZM)
  • Promoter AOX1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvaI partial (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
  • 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Lysozyme gene given by Prof Archer IFRN.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Secreted Human mature lysozyme WT. Also reference PMID: 16441658.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA089 was a gift from Marcos Alcocer (Addgene plasmid # 128518 ; http://n2t.net/addgene:128518 ; RRID:Addgene_128518)
  • For your References section:

    Rationalising lysozyme amyloidosis: insights from the structure and solution dynamics of T70N lysozyme. Johnson RJ, Christodoulou J, Dumoulin M, Caddy GL, Alcocer MJ, Murtagh GJ, Kumita JR, Larsson G, Robinson CV, Archer DB, Luisi B, Dobson CM. J Mol Biol. 2005 Sep 30;352(4):823-36. doi: 10.1016/j.jmb.2005.07.040. 10.1016/j.jmb.2005.07.040 PubMed 16126226