pMJA053
(Plasmid #128515)

• Purpose: Expresses SFA8 in Pichia
• Depositing Lab: Marcos Alcocer
• Publication: Alcocer et al J Mol Biol. 2002 Nov 15;324(1):165-75.

Backbone

• Vector backbone: pPIC9
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 8014
• Vector type: Yeast Expression
• Selectable markers: HIS4

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SFA8 a 2S albumin from sunflower
• Species: Helianthus annus
• Insert Size (bp): 318
• Entrez Gene: LOC110892047 (a.k.a. HannXRQ_Chr11g0337861, 2SS8, SFA8)
• Promoter: AOX1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGACTGGTTCCAATTGACAAGCTTT
• 3′ sequencing primer: TGCATCTCTCAGGCAAATGGCA

Resource Information

• Supplemental Documents:
  • pMJA053=pPIC9+SFA-8.gb
• A portion of this plasmid was derived from a plasmid made by: Given by Prof P Shewry, Rothamstead.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

secreted SFA8 mature 2S albumin storage protein from sunflower seed. Also reference PMID: 12911791.

Addgene NGS found a frameshift and early termination of the a-factor secretion signal-CDS(SFA8)_1 translation, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory has confirmed that this plasmid has been used in the production of intact proteins in large scale fermenters