Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMJA053
(Plasmid #128515)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128515 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPIC9
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8014
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SFA8 a 2S albumin from sunflower
  • Species
    Helianthus annus
  • Insert Size (bp)
    318
  • Entrez Gene
    LOC110892047 (a.k.a. HannXRQ_Chr11g0337861, 2SS8, SFA8)
  • Promoter AOX1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACTGGTTCCAATTGACAAGCTTT
  • 3′ sequencing primer TGCATCTCTCAGGCAAATGGCA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Given by Prof P Shewry, Rothamstead.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

secreted SFA8 mature 2S albumin storage protein from sunflower seed. Also reference PMID: 12911791.

Addgene NGS found a frameshift and early termination of the a-factor secretion signal-CDS(SFA8)_1 translation, compared to the reference sequence provided by the Alcocer laboratory. The Alcocer laboratory has confirmed that this plasmid has been used in the production of intact proteins in large scale fermenters

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMJA053 was a gift from Marcos Alcocer (Addgene plasmid # 128515 ; http://n2t.net/addgene:128515 ; RRID:Addgene_128515)
  • For your References section:

    The disulphide mapping, folding and characterisation of recombinant Ber e 1, an allergenic protein, and SFA8, two sulphur-rich 2S plant albumins. Alcocer MJ, Murtagh GJ, Bailey K, Dumoulin M, Meseguer AS, Parker MJ, Archer DB. J Mol Biol. 2002 Nov 15;324(1):165-75. S0022283602010616 [pii] PubMed 12421566