pMJA008
(Plasmid
#128512)
-
PurposeExpresses Xylanase C
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128512 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4205
-
Vector typeBacterial Expression
-
Selectable markersUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXylanase C
-
Alt nameAJ278385.1
-
SpeciesTalaromyces funiculosus
-
Insert Size (bp)727
- Promoter Histone 4B
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATTACGCCAAGCTCGAAATTAACCCT
- 3′ sequencing primer GTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFrom pAN52 Dr P. Punt Netherlands.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use of histone promoter to drive expression of secreted Xylanase C in Penicillium funiculosum. Also reference 12466887.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMJA008 was a gift from Marcos Alcocer (Addgene plasmid # 128512 ; http://n2t.net/addgene:128512 ; RRID:Addgene_128512) -
For your References section:
A family 11 xylanase from Penicillium funiculosum is strongly inhibited by three wheat xylanase inhibitors. Furniss CS, Belshaw NJ, Alcocer MJ, Williamson G, Elliott GO, Gebruers K, Haigh NP, Fish NM, Kroon PA. Biochim Biophys Acta. 2002 Jul 29;1598(1-2):24-9. PubMed 12147340