pCri-H6-TEV-GRAB
(Plasmid
#128498)
-
PurposeExpresses GRAB (from V34 to N181) (Streptococcus pyogenes serotype M1) in bacterial cells. With N-t H6x tag + TEV.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCri8a
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 5813
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGRAB (Streptococcus pyogenes serotype M1)
-
Alt nameProtein G-related alpha 2M-binding protein
-
Alt nameSPy_1357
-
SpeciesStreptococcus pyogenes serotype M1
-
Insert Size (bp)444
-
GenBank IDNP_269464.1
-
Entrez Genegrab (a.k.a. SPy_1357, SPy1357)
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (6x) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CAATCCATGGTTGATAGCCCGATTG
- 3′ sequencing primer CAATCTCGAGTTAATTAACGTTCTGACGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCri-H6-TEV-GRAB was a gift from F Xavier Gomis-Ruth (Addgene plasmid # 128498 ; http://n2t.net/addgene:128498 ; RRID:Addgene_128498) -
For your References section:
Recombinant production of human alpha2-macroglobulin variants and interaction studies with recombinant G-related alpha2-macroglobulin binding protein and latent transforming growth factor-beta2. Marino-Puertas L, Del Amo-Maestro L, Taules M, Gomis-Ruth FX, Goulas T. Sci Rep. 2019 Jun 24;9(1):9186. doi: 10.1038/s41598-019-45712-z. 10.1038/s41598-019-45712-z PubMed 31235767