pIE-N-hα2M-H6
(Plasmid
#128493)
-
PurposeExpresses human N-α2M (from S24 to E908) in insect cells. With C-t H6x tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIEx
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3843
- Total vector size (bp) 6498
-
Modifications to backboneIntroduction of T after the signal peptide to introduce StuI restriction site = ATGTACAAGCTCACAGTCTTCCTGATGTTCATCGCTTTCGTCATCATCGCTGAGGCCt After AgeI restriction site; introductionn of 6x-His and stop codon = ACCGGTcatcatcaccatcaccatTGA
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA2M (S24-E908)
-
Alt nameCPAMD5
-
Alt nameFWP007
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2655
-
GenBank IDCR749334
-
Entrez GeneA2M (a.k.a. A2MD, CPAMD5, FWP007, S863-7)
- Promoter IE1
-
Tag
/ Fusion Protein
- His tag (6x) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site StuI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GATCTTGGAAATCCTACCGGTCATCATCAC
- 3′ sequencing primer CAATACCGGTTTCAGGTTCAACCAACAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIE-N-hα2M-H6 was a gift from F Xavier Gomis-Ruth (Addgene plasmid # 128493 ; http://n2t.net/addgene:128493 ; RRID:Addgene_128493) -
For your References section:
Recombinant production of human alpha2-macroglobulin variants and interaction studies with recombinant G-related alpha2-macroglobulin binding protein and latent transforming growth factor-beta2. Marino-Puertas L, Del Amo-Maestro L, Taules M, Gomis-Ruth FX, Goulas T. Sci Rep. 2019 Jun 24;9(1):9186. doi: 10.1038/s41598-019-45712-z. 10.1038/s41598-019-45712-z PubMed 31235767