pTrc99S-ssDsbA-MBP-4xDQNAT
(Plasmid #128398)

• Purpose: Periplasmic expression of E. coli MBP with C terminal 4xDQNAT glycosylation sites in E. coli
• Depositing Lab: Michael Jewett
• Publication: Stark et al Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb.

Backbone

• Vector backbone: pTrc99S
• Backbone size w/o insert (bp): 4535
• Total vector size (bp): 5763
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Maltose binding protein
• Species: E. coli
• Insert Size (bp): 1227
• Mutation: Y342H- please see depositor comments
• Promoter: trc
• Tags / Fusion Proteins:
  • 4xDQNAT glycosylation tag (C terminal on insert)
  • 6xHis tag (C terminal on insert)
  • DsbA signal sequence for periplasmic translocation (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACAATTAATCATCCGGCTCG
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Supplemental Documents:
  • pTrc99s-ssDsbA-MBP-4xDQNAT.gb
• A portion of this plasmid was derived from a plasmid made by: E. coli MBP 4xDQNAT is from pTrc99A-MBP-4x-DQNAT Valderrama-Rincon, et al. doi.org/10.1038/nchembio.921

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Depositor confirms mutation Y342H does not affect plasmid function.