pJL1-TTc-4xDQNAT
(Plasmid #128393)

• Purpose: In vitro expression of tetanus toxin fragment C with C terminal 4xDQNAT glycosylation sites
• Depositing Lab: Michael Jewett
• Publication: Stark et al Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb.

Backbone

• Vector backbone: pJL1
• Backbone size w/o insert (bp): 1765
• Total vector size (bp): 3229
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tetanus toxin fragment C domain
• Species: C. tetani
• Insert Size (bp): 1467
• Promoter: T7
• Tags / Fusion Proteins:
  • 4xDQNAT glycosylation tag (C terminal on insert)
  • 6xHis tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGTTATTGCTCAGCGGTGG

Resource Information

• Supplemental Documents:
  • pJL1-TTc-4xDQNAT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry