Skip to main content
Addgene

pJL1-MBP-4xDQNAT
(Plasmid #128390)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128390 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1765
  • Total vector size (bp) 2989
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Maltose binding protein
  • Species
    E. coli
  • Insert Size (bp)
    1227
  • Mutation
    A302T- please see depositor comment
  • Promoter T7
  • Tags / Fusion Proteins
    • 4xDQNAT glycosylation tag (C terminal on insert)
    • 6xHis tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    E. coli MBP 4xDQNAT is from pTrc99A-MBP-4x-DQNAT Valderrama-Rincon, et al. doi.org/10.1038/nchembio.921

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirms mutation does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1-MBP-4xDQNAT was a gift from Michael Jewett (Addgene plasmid # 128390 ; http://n2t.net/addgene:128390 ; RRID:Addgene_128390)
  • For your References section:

    On-demand biomanufacturing of protective conjugate vaccines. Stark JC, Jaroentomeechai T, Moeller TD, Hershewe JM, Warfel KF, Moricz BS, Martini AM, Dubner RS, Hsu KJ, Stevenson TC, Jones BD, DeLisa MP, Jewett MC. Sci Adv. 2021 Feb 3;7(6). pii: 7/6/eabe9444. doi: 10.1126/sciadv.abe9444. Print 2021 Feb. 10.1126/sciadv.abe9444 PubMed 33536221