Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSDMA67
(Plasmid #128356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128356 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBlueScript II SK(-)
  • Backbone manufacturer
    Stratagene
  • Vector type
    Unspecified
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Noureothricin (NAT)
  • gRNA/shRNA sequence
    AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
  • Species
    Synthetic
  • Promoter ACT1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: The plasmid contains a 390bp discrepancy in C-terminus of the LacZ Split. This region of the plasmid serves no purpose other than for screening and hosting the MCS used in generating the plasmid. This difference is not expected to affect the final function of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSDMA67 was a gift from James Fraser (Addgene plasmid # 128356 ; http://n2t.net/addgene:128356 ; RRID:Addgene_128356)
  • For your References section:

    Targeted Genome Editing via CRISPR in the Pathogen Cryptococcus neoformans. Arras SD, Chua SM, Wizrah MS, Faint JA, Yap AS, Fraser JA. PLoS One. 2016 Oct 6;11(10):e0164322. doi: 10.1371/journal.pone.0164322. eCollection 2016. 10.1371/journal.pone.0164322 PubMed 27711143