pSDMA67
(Plasmid
#128356)
-
PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBlueScript II SK(-)
-
Backbone manufacturerStratagene
-
Vector typeUnspecified
-
Selectable markersNourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNoureothricin (NAT)
-
gRNA/shRNA sequenceAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
-
SpeciesSynthetic
- Promoter ACT1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The plasmid contains a 390bp discrepancy in C-terminus of the LacZ Split. This region of the plasmid serves no purpose other than for screening and hosting the MCS used in generating the plasmid. This difference is not expected to affect the final function of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSDMA67 was a gift from James Fraser (Addgene plasmid # 128356 ; http://n2t.net/addgene:128356 ; RRID:Addgene_128356) -
For your References section:
Targeted Genome Editing via CRISPR in the Pathogen Cryptococcus neoformans. Arras SD, Chua SM, Wizrah MS, Faint JA, Yap AS, Fraser JA. PLoS One. 2016 Oct 6;11(10):e0164322. doi: 10.1371/journal.pone.0164322. eCollection 2016. 10.1371/journal.pone.0164322 PubMed 27711143