pCIneoLuc-PP2A
(Plasmid
#128349)
-
PurposeVector for LUMIER assay
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePP2A
-
Alt namePTPA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1080
-
GenBank ID5524
-
Entrez GenePTPA (a.k.a. PARK25, PP2A, PPP2R4, PR53)
- Promoter CMV
-
Tag
/ Fusion Protein
- Luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gataggcacctattggtcttactgacat
- 3′ sequencing primer Gaacctgaaacataaaatgaat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The PP2A insert contains a H804Q mismatch compared to the NCBI reference.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIneoLuc-PP2A was a gift from Yutaka Hata (Addgene plasmid # 128349 ; http://n2t.net/addgene:128349 ; RRID:Addgene_128349) -
For your References section:
A cell-based screening for TAZ activators identifies ethacridine, a widely used antiseptic and abortifacient, as a compound that promotes dephosphorylation of TAZ and inhibits adipogenesis in C3H10T1/2 cells. Kawano S, Maruyama J, Nagashima S, Inami K, Qiu W, Iwasa H, Nakagawa K, Ishigami-Yuasa M, Kagechika H, Nishina H, Hata Y. J Biochem. 2015 May 14. pii: mvv051. 10.1093/jb/mvv051 PubMed 25979969