Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCIneoMyc UNC119B
(Plasmid #128333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128333 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCIneo
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UNC119B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    760
  • GenBank ID
    84747
  • Entrez Gene
    UNC119B (a.k.a. POC7B)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer gataggcacctattggtcttactgacat
  • 3′ sequencing primer Gaacctgaaacataaaatgaat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIneoMyc UNC119B was a gift from Yutaka Hata (Addgene plasmid # 128333 ; http://n2t.net/addgene:128333 ; RRID:Addgene_128333)
  • For your References section:

    UNC119 is a binding partner of tumor suppressor Ras-association domain family 6 and induces apoptosis and cell cycle arrest by MDM2 and p53. Iwasa H, Sarkar A, Shimizu T, Sawada T, Hossain S, Xu X, Maruyama J, Arimoto-Matsuzaki K, Withanage K, Nakagawa K, Kurihara H, Kuroyanagi H, Hata Y. Cancer Sci. 2018 Sep;109(9):2767-2780. doi: 10.1111/cas.13706. Epub 2018 Jul 28. 10.1111/cas.13706 PubMed 29931788